Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.
Comment: Migrated to Confluence 4.0


The FASTA format is a general sequence format composed of a header starting with '>' followed by the sequence identifier. The next line then contains the sequence. More detailed information is available here.

E-RNAi only allows sequences containing A, C, G, T nucleotides. Sequences can contain newlines.

Example

>TargetSeq_1
ACGACGCGCAGCAGGTGGTTTAAGATA
TCGATGACAGACTACAGACTAAGATAA
GGCCGGAAGGTTTATTCGACGATAGCA
AGTAGCATCGACAGCATCAGATAGC
>TargetSeq_2
CAGCGACGACGAACGCATGTGCGACTG
AATAGTCAGATAGAGAATTCGGATGGA
TTAGTAGATAGACGACAGA