Child pages
  • Homo sapiens siRNAs

Versions Compared

Key

  • This line was added.
  • This line was removed.
  • Formatting was changed.
Comment: Migrated to Confluence 4.0

...

human.rnaMOD.COMMON_mdust_split_crsplit.zip (20MB) containing target sequences as input file (-i input).

Code Block
borderColorgrey
borderStyledashed
>LOC729774_cr1:1
CCAAGCCTGCAGCAGGGAGAGCAACAAGCCCTGGCCCTCAGAGCTCAGCCGGATGAGCGCAGCCCAGAG
ACAGCAGCTTCTCGAGGAAGGAAGGACCCGGTTTCAGGAGCTGCTGTCCAGTCCGGCCTACAGAGCCAG
CACCCTGGTGGCCATCGGGCAGACGCTGGCCCGGCAGATGCAGCTGGAAGATGGCGGCCAGCTCTGA
>LOC100128610_cr3:1
ATGAGGCTGAGTCTTATCCCTCGGAACACGGGCACCCCACAGAGGGTCCTGCCTCCTGTGGTCTGGAGC
TCCCCCTCAAGGAAGAAACCCTTGCTGTCTGCTTGCAACTCCATGATGTTTGGACACCTCAGCCCCGTG
AGGATCCCTTATCTCAGAGGCAAGTTTAAC
>RNF185_cr2:1
AAGTCCCTCCGAGAGGGGCGGCTCCGCGTCATGTGACTGGAGTCCGCGTAGGAGGGGTCGGAGGTCTTA
CCCAACAGATTGACGCGGCGTTAGTATTGGCCGTGTACCCGAAAAACTGATTGACTGGGCTGGCGTTAA
CTGTGCGGAGG

...

TargetGroups_GeneID.tab (1.3MB) defining which RefSeq transcripts belong to the same gene (headers Target and TargetGroup) (TARGETGROUPS option)

Code Block
borderColorgrey
borderStyledashed
Target          TargetGroup     TargetGroup2
NM_001012993.2  C9orf152        401546
NM_001015.3     RPS11           6205
XM_002348062.1  LOC100291269    100291269
NM_182764.1     ELMO2           63916
NM_133171.3     ELMO2           63916
NM_052854.2     CREB3L1         90993
NM_006029.4     PNMA1           9240
NM_004530.4     MMP2            4313
NM_001127891.1  MMP2            4313

...

Bowtie database/index containing annotated RefSeq transcripts (release 40) for specificity calculations (-d input):
human.rnaMOD.tar.gz (114MB)

...

Tab-delimited feature file containing mappings of UTRs and SNPs (from NCBI dbSNP) to chromosomes that is used to calculate UTR and SNP 'contents' (FEATURE option) of designed reagents: Hs_UTR_SNP.tar.gz (484MB)

...

Transcriptome FASTA file to evaluate the homology of the designs using Blast (HOMOLOGY and TXNFASTA options):
human.rnaMOD.fna.zip (32MB)

...

To compute the number of siRNA seed matches (seed complement frequency) a Bowtie database/index containing all annotated 3'-UTR sequences (RefSeq release 40) was generated to be used with the SEEDMATCH option (Hs_3UTR.tar.gz (26MB)).

...