Skip to end of metadata
Go to start of metadata


RNAi experiments in mammalian systems require the application of either in vitro diced long dsRNAs (esiRNAs) or synthetic siRNAs. NEXT-RNAi was used to design a genome-wide esiRNA library targeting all human genes annotated by the NCBI RefSeq database (release 40). To this end regions common to all RefSeq transcripts belonging to the same gene were computed for the complete human genome (37,627 regions). Further, sequences of low-complexity were filtered using mdust and remaining sequences longer 560 nt were splitted into two sequences to obtain a higher number of potential target sites for NEXT-RNAi reagent designs. Overall this resulted in 83,416 input sequences used as input for NEXT-RNAi.


NEXT-RNAi results

NEXT-RNAi HTML ouputs are available here

Overall 82,516 designs were obtained, covering 97.8% of the genome. 73.8% of all genes are covered by at least one design that does not show homology of 19 nt or longer to any other gene. 88.4% of all genes are additionally covered by at least one second, independent design.


Input files and settings used

Input FASTA file

human.rnaMOD.COMMON_mdust_split_crsplit.zip (20MB) containing target sequences as input file (-i input).

>LOC729774_cr1:1
CCAAGCCTGCAGCAGGGAGAGCAACAAGCCCTGGCCCTCAGAGCTCAGCCGGATGAGCGCAGCCCAGAG
ACAGCAGCTTCTCGAGGAAGGAAGGACCCGGTTTCAGGAGCTGCTGTCCAGTCCGGCCTACAGAGCCAG
CACCCTGGTGGCCATCGGGCAGACGCTGGCCCGGCAGATGCAGCTGGAAGATGGCGGCCAGCTCTGA
>LOC100128610_cr3:1
ATGAGGCTGAGTCTTATCCCTCGGAACACGGGCACCCCACAGAGGGTCCTGCCTCCTGTGGTCTGGAGC
TCCCCCTCAAGGAAGAAACCCTTGCTGTCTGCTTGCAACTCCATGATGTTTGGACACCTCAGCCCCGTG
AGGATCCCTTATCTCAGAGGCAAGTTTAAC
>RNF185_cr2:1
AAGTCCCTCCGAGAGGGGCGGCTCCGCGTCATGTGACTGGAGTCCGCGTAGGAGGGGTCGGAGGTCTTA
CCCAACAGATTGACGCGGCGTTAGTATTGGCCGTGTACCCGAAAAACTGATTGACTGGGCTGGCGTTAA
CTGTGCGGAGG

Targetgroup file (tab-delimited)

TargetGroups_GeneID.tab (1.3MB) defining which RefSeq transcripts belong to the same gene (headers Target and TargetGroup) (TARGETGROUPS option)

Target          TargetGroup     TargetGroup2
NM_001012993.2  C9orf152        401546
NM_001015.3     RPS11           6205
XM_002348062.1  LOC100291269    100291269
NM_182764.1     ELMO2           63916
NM_133171.3     ELMO2           63916
NM_052854.2     CREB3L1         90993
NM_006029.4     PNMA1           9240
NM_004530.4     MMP2            4313
NM_001127891.1  MMP2            4313

Bowtie database/index for off-target evaluation

Bowtie database/index containing annotated RefSeq transcripts (release 40) for specificity calculations (-d input):
human.rnaMOD.tar.gz (114MB)

Feature file with UTR and SNP locations

Tab-delimited feature file containing mappings of UTRs and SNPs (from NCBI dbSNP) to chromosomes that is used to calculate UTR and SNP 'contents' (FEATURE option) of designed reagents: Hs_UTR_SNP.tar.gz (484MB)

ID           FeatureName     FeatureLoc      FeatureStart    FeatureEnd
UTR_1        UTR             11              11643172        11643172
UTR_2        UTR             11              6741799         6741799
UTR_3        UTR             11              127219          127219
UTR_4        UTR             11              2662385         2662385
UTR_5        UTR             11              45952962        45952962
rs80303196   SNP             6               29985811        29985811
rs80303196   SNP             6               32995534        32995534
rs80303196   SNP             6               29080247        29080247
rs80303196   SNP             6               30038873        30038873
rs80303196   SNP             6               32181031        32181031

FASTA file for homology evaluation

Transcriptome FASTA file to evaluate the homology of the designs using Blast (HOMOLOGY option):
human.rnaMOD.fna.zip (32MB)


Design criteria

Start of program

perl nextrnai.pl -i human.rnaMOD.COMMON_mdust_split_crsplit.fa -s 5000 -r d
-d human.rnaMOD -e NO -o options.txt -n Hs_RefSeq40


Descriptions for start parameters used are available here.

Options file

DESIGNWINDOW=80,250
DESIGNNUM=50
OUTPUTNUM=1
SIRNALENGTH=19
EFFICIENCY=SIR,0
REDESIGN=ON
INTRON=90
BOWTIE=/usr/bin/
TARGETGROUPS=TargetGroups_GeneID.tab
PRIMER3=/usr/bin/
SOURCE=CDS
BLAT=/usr/bin/
BLATPROGRAM=gfClient
BLATHOST=b110-cellarray3
BLATPORT=3500
GFF=GFF3
GBROWSEBASE=http://www.dkfz.de/signaling/cgi-bin/gbrowse_img/hsrefseq/
GBROWSETRACK=GENE+TXN+ENSEMBLGENESPAN+ENSEMBLGENE
AFF=YES
CANEVAL=6
HOMOLOGY=/usr/bin/,human.rnaMOD.fna,1e-10
FEATURE=Hs_UTR_SNP.tab
RANKD=SPEC


Descriptions for all options used are available here.


  • No labels