Skip to end of metadata
Go to start of metadata


The sequence of the Drosophila melanogaster genome is available for several years and gene models are well annotated through computational and experimental strategies. NEXT-RNAi was used to design multiple independent long dsRNAs covering all Drosophila genes based on the latest genome release (FlyBase release 5.24). Each design was intended to target all splice variants of a given target gene. Overall approx. 74,900 common regions for 14,898 annotated coding and non-coding genes were selected as target sites, resulting in an average of about 5 regions per gene. The Drosophila transcriptome was used as database to evaluate siRNA specificities.


NEXT-RNAi results

NEXT-RNAi HTML ouputs are available here

Overall ~70,149 designs were obtained, covering 99.4% of the genome. 83 gene models could not be targeted due to low complexity regions that are not suitable for primer design. 90.7% of all genes are covered by a design that does not show homology of 19 nt or longer to any other gene. 88.7% of all genes are covered by at least one second, independent design.


Input files and settings used

Input FASTA file

COMMON_REGIONS_r5.24_ALL_EXTENDED_split_long.zip (8.2 MB) containing target sequences as input file (-i input).

>FBgn0029994_cr4
AGTGTTTACTTTGCTCAATATTCAGTCCGAATTCGTTAACAGCCGCTAACGGTTTGCTCCGGCTGCTCC
GATCCCTTCCTATATACGTATATATATATATAGATATATATATACATTAACGATCCTCGCAGGATTTAG
CCAAATACACGAAACATGTCGAAAGTGACGCAAAG
>FBgn0037191_cr1_1
CAAGACTTTTAATGTAGTTTTAATTTTTGAACTAATCGACCGTGTACATTTAGTAGTAACATTTTTTTC
ATATTGGCTAAGGATGAACAAAAGCCAAAAGTCCCTGGCGGACGACATGGCCTCGACGCCTTTCGGCAA
GGAGGTGCTGATTGGCAACTGGGCGGAGCGCCGCTACGCAGTCGAGGAGCAGAGCAATGCCATCCTGCC
AGGACTCCGTGTGAGTGGTTGCGAGCTCCATAGGTCGCTCTGCCACGACACCTACACTACTGCACCCTT
CGTTGGCGCCGAGGCAGTACCCTTGTTTGTGGATCATCGCAAATTGGCTTACAAGAACTTTATAAGGAA
TAGGCGATCTAGCTTGAACCTGGTGGACGATGAGCTACTCAAGAGGAACTTCACTACCA

Targetgroup file (tab-delimited)

FBtr-FBgn-CG-Txn-Name-r5.24.tab (1.4MB) defining which FlyBase transcripts belong to the same gene (headers Target and TargetGroup) (TARGETGROUPS option)

Target	        TargetGroup	#1	        #2	        #3	#4
FBtr0085315	FBgn0039596	CG10000-RA	CG10000-RA	CG10000	CG10000
FBtr0085316	FBgn0039595	AR-2-RA	        CG10001-RA	CG10001	AR-2
FBtr0085321	FBgn0000659	fkh-RA    	CG10002-RA	CG10002	fkh
FBtr0300259	FBgn0000659	fkh-RB	        CG10002-RB	CG10002	fkh
FBtr0082507	FBgn0037972	CG10005-RA	CG10005-RA	CG10005	CG10005

Intended target file

COMMON_REGIONS_r5.24_ALL_EXTENDED_split.intended (2.1MB) defining intended gene targets of queried identifiers (helps NEXT-RNAi to show intended target of a long dsRNA as first target in case it has multiple perfect targets) (INTENDED option). Here the intended gene targets are equal to the defined TargetGroup.

Query	            Intended
FBgn0029994_cr1	    FBgn0029994
FBgn0029994_cr2	    FBgn0029994
FBgn0029994_cr3	    FBgn0029994
FBgn0029994_cr4	    FBgn0029994
FBgn0037191_cr1_1   FBgn0037191
FBgn0037191_cr1_2   FBgn0037191
FBgn0036810_cr1_1   FBgn0036810

Bowtie database/index for off-target evaluation

Bowtie database/index containing annotated FlyBase (release 5.24) transcripts for specificity calculations (-d input):
dmel-all-txn-miRNA-miscRNA-ncRNA-pseudogene-tRNA-r5.24.fasta.tar.gz (55MB)

Bowtie database/index for mapping of reagents

The Bowtie database/index (GENOMEBOWTIE option) for mapping of reagents to the Drosophila genome:
dmel-all-chromosome-r5.24.tar.gz (154MB)
Bowtie indexes for genomes are also available through the Bowtie webpage.

Feature file with UTR locations

Tab-delimited feature file containing FlyBase mappings of UTRs to chromosomes that is used to calculate the 'UTR-content' (FEATURE option) of designed reagents: dmel-all-UTRs-r5.24.zip (65MB)

UTRID    FeatureName    FeatureLoc    FeatureStart    FeatureEnd
UTR_1    UTR            2RHet         2901830         2901830
UTR_2    UTR            2RHet         1335191         1335191
UTR_3    UTR            2RHet         198854          198854

FASTA file for homology evaluation

Transcriptome FASTA file to evaluate the homology of the designs using Blast (HOMOLOGY option):
dmel-all-txn-miRNA-miscRNA-ncRNA-pseudogene-tRNA-r5.24.fasta.zip (14MB)

FASTA file containing miRNAs (miRBase)

FASTA file containing miRNAs downloaded from miRBase used to avoid conserved miRNA seeds from long dsRNA designs (MIRSEED option):
miRBase_r14_Dmel.fa (16KB)


Design criteria

Start of program

perl nextrnai.pl -i COMMON_REGIONS_r5.24_ALL_EXTENDED_split_long.fa -s 2500
-r d -d dmel-all-txn-miRNA-miscRNA-ncRNA-pseudogene-tRNA-r5.24.fasta -e NO
-o options.txt -n Dmel_r524


Descriptions for start parameters used are available here.

Options file

DESIGNWINDOW=80,250
DESIGNNUM=50
OUTPUTNUM=1
SIRNALENGTH=19
EFFICIENCY=SIR,0
REDESIGN=ON
INTRON=90
BOWTIE=/usr/bin/
TARGETGROUPS=FBtr-FBgn-CG-Txn-Name-r5.24.tab
INTENDED=COMMON_REGIONS_r5.24_ALL_EXTENDED_split.intended
PRIMER3=/usr/bin/
GENOMEBOWTIE=dmel-all-chromosome-r5.24
GFF=GFF3
GBROWSEBASE=http://www.dkfz.de/signaling/cgi-bin/gbrowse_img/flybase/
GBROWSETRACK=GENE+TXN
AFF=YES
LOWCOMPEVAL=/usr/bin/
CANEVAL=6
HOMOLOGY=/usr/bin/,dmel-all-txn-miRNA-miscRNA-ncRNA-pseudogene-tRNA-r5.24.fasta,1e-10
FEATURE=dmel-all-UTRs-r5.24.tab
MIRSEED=7,miRBase_r14_Dmel.fa
RANKD=SPEC


Descriptions for all options used are available here.


  • No labels