Skip to end of metadata
Go to start of metadata


The mosquito Anopheles gambiae is widely studied to dissect mechanism of innate immunity in its response to Plasmodium falciparum. RNAi can be used in Anopheles tissue culture as well as in live mosquitoes for in vivo studies, leading to efficient depletion of target mRNAs. We used VectorBase annotations to generate input files for NEXT-RNAi. Specifically we designed long dsRNAs against 62,138 exons annotated for the mosquito genome (exons longer 560 nt were splitted in two sequences, resulting in overall 74,944 input sequences for NEXT-RNAi).


NEXT-RNAi results

NEXT-RNAi HTML ouputs are available here

Overall 68.855 designs were obtained, covering 95% of the genome. 89.2% of all genes are covered by at least one design that does not show homology of 19 nt or longer to any other gene. 90.1% of all genes are additionally covered by at least one second, independent design.


Input files and settings used

Input FASTA file

>AGAP007336:4_1
AATCAGACTCGACGGAGATGCTCGACTCGGAGACGGAACCGTGCCTCATGATGGACAACGTGCTCGAGG
ACGTGACGATGCCGGACTCGCATTCCCACAACATGGTTTCGTCGTCGACCCGCATCTCCCAGATCGAGA
TGCCATCGTCGCTCGAGAGTGGCGTTGGAGCGACCAGCAACGCGATGACGATGGCGCACGACGAATCGC
TCGATAATCTTTCGCAGGCCATCGCTAACCGGCAGCAGATTGAGCTGCAGTCAAACATGATAGCTAGTG
GTCGGTCGTCACGGTTCCACCATTCGGTCGGTAGCA
>AGAP007336:4_2
ACAACGACCAGCAGCAGCACCAACAGCAACCGTCTCGCAACACACCGTCCGTGGTAACGTCGGCGGCGG
CAGCTATGACGACCGCTCCGGACCACACGACCGCAAGCCACTCTTCGTCGCTGGACGACGAGGAGAACA
GCTGCTGCGCGGAGGCGTCGATGGCCGAAATGCCGTCGATTTGCGAGTACTGCAACGCGCAGTCGCTGG
TGGATCAGGTGATCGATGTGGACAATCTGATCACGAAGCTGCTGAAGGTGTTGCGGATCGTCCAGATGG
ATAATGATCACTGCATACAGGAGCTGATCAATCATAA

Targetgroup file (tab-delimited)

agambiae_targetgroups.tab (352KB) defining which VectoBase transcripts belong to the same gene (headers Target and TargetGroup) (TARGETGROUPS option

Target          TargetGroup
AGAP000002-RA   AGAP000002
AGAP000005-RA   AGAP000005
AGAP000007-RA   AGAP000007
AGAP000008-RA   AGAP000008
AGAP000009-RC   AGAP000009
AGAP000009-RB   AGAP000009
AGAP000009-RA   AGAP000009
AGAP000010-RA   AGAP000010

Bowtie database/index for off-target evaluation

Bowtie database/index containing annotated VectorBase transcripts for specificity calculations (-d input):
agambiae_transcript.tar.gz (28MB)

Bowtie database/index for mapping of reagents

The Bowtie database/index (GENOMEBOWTIE option) for mapping of reagents to the Anopheles genome:
agambiae_genome.tar.gz (250MB)
Bowtie indexes for genomes are also available through the Bowtie webpage.

FASTA file for homology evaluation

Transcriptome FASTA file to evaluate the homology of the designs using Blast (HOMOLOGY option):
agambiae_transcript.zip (14MB)


Design criteria

Start of program

perl nextrnai.pl -i agambiae_exons_split.fa -s 2500 -r d -d agambiae_transcript
-e NO -o options.txt -n AgamP3.5


Descriptions for start parameters used are available here.

Options file

DESIGNWINDOW=80,250
DESIGNNUM=50
OUTPUTNUM=1
SIRNALENGTH=19
EFFICIENCY=SIR,0
REDESIGN=ON
BOWTIE=/usr/bin/
TARGETGROUPS=agambiae_targetgroups.tab
PRIMER3=/usr/bin/
GENOMEBOWTIE=agambiae_genome
GFF=GFF3
GBROWSEBASE=http://www.dkfz.de/signaling/cgi-bin/gbrowse_img/agambiae/
GBROWSETRACK=GENE+TXN
AFF=YES
LOWCOMPEVAL=/usr/bin/
CANEVAL=6
HOMOLOGY=/usr/bin/,agambiae_transcript.fa,1e-10
RANKD=SPEC


Descriptions for all options used are available here.


  • No labels