Skip to end of metadata
Go to start of metadata


E-RNAi offers a variety of output formats documented below.


Page contents


Summary statistics


E-RNAi was queried for the D. melanogaster genes FBgn0014018, wls and CG2956 as described here.
The output first provides a summary statistics about the number of successful designs.


In this example 4 target sequences were queried, 4 designs could be calculated according to the selected design options.


Links to HTML results


These links lead to detailed reports for each designed RNAi reagent. In the images below the output for one of these designs targeting the gene relish is discussed.


dsRNA information


The first box is focussed on the properties of the primer pair designed to synthesize this long dsRNA as well as on the properties of the dsRNA itself.



Primer sequence

Sequence (5'-3') of the primer. If queried, tags are attached to the 5'-end of the primer (here the T7 promoter 'taatacgactcactataggg') in lowercase letters.

Primer length [nt]

Length (in nt) of the primer (without tag sequence).

Primer Tm[°C]

Melting temperature of the primer in degrees Celcius (calculated without tag sequence).

Primer GC[%]

GC content (in percent) of the primer (calculated without tag sequence).

Primer pair penalty

Assembled penalty of forward and reverse primer (from primer3). The higher the worse the primer pair is.

Amplicon sequence

Sequence (5'-3') of the amplified product (without tags).

Amplicon length [nt]

Length (in nt) of the amplified product.

Amplicon location

Location of the amplified product in the genome of the organism in the format chromosome:start..end(orientation). For some organisms, where the genome is not completely assembled, the amplified product is mapped to contigs.


Target information


This part of the output summarizes all genes and annotated transcripts targeted by the RNAi reagent. This information is based on the mapping of all siRNAs sequences calculated from the designed reagent to the organism's transcriptome. The long dsRNA designed in this example has a length of 468 nt. The settings were adjusted such that any (perfect) 19 nt off-target matches should be avoided. 468 19 nt siRNAs can be generated from this sequence (using an offset of 1). Here only one gene (FBgn0014018) is targeted and the annotated isoforms are targeted by all possible 468 siRNAs.



Intended target gene

Best target gene(s) (considered as intended) based on the number of siRNAs matching its annotated transcripts. If multiple genes are targeted with the same number of siRNAs they are separated by comma.

Intended target transcripts (hits)

Transcripts annotated for the intended target gene(s) with number of siRNA hits in brackets. All annotated transcripts are listed here, even if not all of them are targeted. If multiple intended genes were found transcripts belonging to the same intended target gene are separated by comma. A semicolon then indicates that the following transcripts belong to the next intended target gene.

Other targeted gene(s)

All other genes targeted by less siRNAs are listed here, separated by comma. 'NA' indicates that no other target genes were found.

Other targeted transcripts (hits)

Transcripts annotated for the other targeted gene(s) with number of siRNA hits in brackets. All annotated transcripts are listed here, even if not all of them are targeted. If multiple other targeted genes were found transcripts belonging to the same intended target gene are separated by comma. A semicolon then indicates that the following transcripts belong to the next targeted gene.


Reagent quality



siRNAs [19 nt]

Number of possible siRNAs calculated from the RNAi reagent sequences (here 19 nt).

On-target

Number of specific siRNAs, only targeting transcripts of a single (intended) target gene.

Off-target

Number of unspecific siRNAs targeting transcripts of unintended genes besides those of the intended target gene.

No-target

Number of siRNAs with no target. This might occur e.g. in case an intron spanning long dsRNA was designed.

Efficient siRNAs

Number of siRNAs within a designed long dsRNA with a predicted efficiency above the selected 'Minimal siRNA efficiency score' and according to the selected efficiency calculation method ('rational' or 'weighted'). The efficiency calculation is based on 19 nt siRNAs and can take values between 0 and 100. Here the 20 was used as cut-off. In the example shown 450 out of 468 siRNAs have an efficiency above or equal 20. A more detailed description of the efficiency prediction is available here.

Avg efficiency score

Average efficiency score of all 19 nt siRNAs contained in the designed long dsRNA according to the selected efficiency calculation method ('rational' or 'weighted'). A more detailed description of the efficiency prediction is available here.

LowComplexRegions

Number of low complexity regions (calculated with mDust) in the reagent's sequence. This value optimally should be 0.

CAN

Number of stretches with at least 6 contiguous CA[ACGT] (CAN) repeats. This value optimally should be 0.

Additional quality evaluation


This section reports on additional evaluations of the designed RNAi reagent.



Sequence homology (e-value)

Predicted homology of the RNAi reagent to genes in the genome. Only homologies with E-values (according to BLAST output) below the cut-off selected on the settings page are reported. Optimally the RNAi reagent has significant homology to the intended target gene only (multiple homologous targets are separated by '&'). Significant homologies to other genes might give rise to off-target effects.


Genome browser


This image visualizes the designed reagent in its genomic context using the generic genome browser (GBrowse). It shows four tracks: the absolute location on the chromosome or contig (e.g. here 3R from ca. 4868 kbp to 4874 kbp), a 'Gene span track' containing the gene model, a 'Transcripts' track containing annotated transcripts and the 'RNAi' track showing the location of the actual design.



Results as flat files


Here all design results and statistics as well as reports from running E-RNAi are linked as flat files that can be easily loaded and manipulated in any kind of editor or spreadsheet software.



Tab-delimited result file


Regarding its content this file resembles the 'HTML results' for all designed reagents in a simple tab-delimited format.





QueryID

Identifier of the queried target sequence.

QuerySubID

Identifier of the RNAi reagent composed of the target sequence identifier, '_' and an index that is incremented by 1 if multiple designs are queried for the same target sequence.

Length[nt]

Length (in nt) of the RNAi reagent.

SeqFor

Sequence (5'-3') of the forward primer. If queried, tags are attached to the 5'-end of the primer (here the T7 promoter 'taatacgactcactataggg') in lowercase letters.

PosFor

Starting position of the forward primer in the queried target sequence (starting at 0).

LenFor

Length (in nt) of the primer (without tag sequence).

GCFor[%]

GC content (in percent) of the primer (calculated without tag sequence).

TmFor[*C]

Melting temperature of the primer in degrees Celcius (calculated without tag sequence).

SeqRev

Sequence (5'-3') of the reverse primer. If queried, tags are attached to the 5'-end of the primer (here the T7 promoter 'taatacgactcactataggg') in lowercase letters.

PosRev

Starting position of the reverse primer in the queried target sequence (starting at 0).

LenRev

Length (in nt) of the primer (without tag sequence).

GCRev[%]

GC content (in percent) of the primer (calculated without tag sequence).

TmRev[*C]

Melting temperature of the primer in degrees Celcius (calculated without tag sequence).

ForRevPenalty

Assembled penalty of forward and reverse primer (from primer3). The higher the worse the primer pair is.

Specificity[Abs]

Absolute predicted specificity of siRNAs calculated from the RNAi reagent in the format Overall number of siRNAs calculates from the RNAi reagent / On-target siRNAs / Off-target siRNAs / No-target siRNAs. 'On-target' refers to siRNAs only targeting transcripts of a single (intended) target gene. 'Off-target' refers to unspecific siRNAs targeting transcripts of unintended genes besides those of the intended target gene. 'No-target' refers to siRNAs targeting no transcript at all (e.g. in case of intron-spanning designs).

Specificity[%]

Percentage of specific siRNAs of the number of all siRNAs.

EfficientsiRNAs

Number of siRNAs within a designed long dsRNA with a predicted efficiency above the selected 'Minimal siRNA efficiency score' and according to the selected efficiency calculation method ('rational' or 'weighted'). The efficiency calculation is based on 19 nt siRNAs and can take values between 0 and 100. Here 20 was used as cut-off. A more detailed description of the efficiency prediction is available here.

AvgEfficiencyScore

Average efficiency score of all 19 nt siRNAs contained in the designed long dsRNA according to the selected efficiency calculation method ('rational' or 'weighted'). A more detailed description of the efficiency prediction is available here.

Sequence

Sequence (5'-3') of the RNAi reagent (without tags).

IntendedGene

Best target gene(s) (considered as intended) based on the number of siRNAs matching its annotated transcripts. If multiple genes are targeted with the same number of siRNAs they are separated by '&'.

IntendedTxn

Transcripts annotated for the intended target gene(s). All annotated transcripts are listed here, even if not all of them are targeted. If multiple intended genes were found transcripts belonging to the same intended target gene are separated by '+'. A '&' then indicates that the following transcripts belong to the next intended target gene.

IntendedTxnHits

Number of siRNAs targeting the transcripts in the column 'IntendedTxn' in the same order and separation.

OtherGene

All other genes targeted by less siRNAs are listed here, separated by comma. 'NA' indicates that no other target genes were found.

OtherTxn

Transcripts annotated for the other targeted gene(s). All annotated transcripts are listed here, even if not all of them are targeted. If multiple other targeted genes were found transcripts belonging to the same intended target gene are separated by '+'. A '&' then indicates that the following transcripts belong to the next targeted gene.

OtherTxnHits

Number of siRNAs targeting the transcripts in the column 'OtherTxn' in the same order and separation.

Location

Location of the amplified product in the genome of the organism in the format chromosome:start..end(orientation). For some organisms, where the genome is not completely assembled, the amplified product is mapped to contigs.

LowComplexRegions

Number of low complexity regions (calculated with mDust) in the reagent's sequence. This value optimally should be 0.

CANRepeats

Number of stretches with at least 6 contiguous CA[ACGT] (CAN) repeats. This value optimally should be 0.

Homology

Predicted homology of the RNAi reagent to genes in the genome. Only homologies with E-values (according to BLAST output) below the cut-off selected on the settings page are reported. Optimally the RNAi reagent has significant homology to the intended target gene only (multiple homologous targets are separated by '&'). Significant homologies to other genes might give rise to off-target effects.


Statistics result file



This file reports on some statistics of the designed reagents and is also presented in HTML format on the main output page (see image above).

This file reports the:

  • average and standard deviation of primer length (in nt), GC content (in %), melting temperature (in °C) and penalty (important for similar PCR efficiency)
  • average and standard deviation of siRNAs predicted to be efficient (for long dsRNA designs) or predicted siRNA efficiency (for siRNA designs)
  • summarized predicted specificity of all reagents (reagents with only 1 target, with multiple targets, with no target, with CAN repeats, with low-complexity regions etc.)
  • number of designs that could be mapped to the genome


FASTA result file



This file contains the designed RNAi reagents in FASTA format (see example above).


GFF result file



This file contains the designed RNAi reagents in generic feature format of version 3 (GFF3, see example above) that can be used with GBrowse or other genome browser to visualize the location of the designs in their genomic context. Further information about the GFF3 format is available here.


AFF result file



This file contains the designed RNAi reagents in annotation file format (AFF, see example above) that can be directly uploaded to GBrowse to visualize the designs as new track in a public available genome browser. Documentation about this format can e.g. be found here.


Oligo(s) that could not be mapped


This file contains a list of identifiers of all designed RNAi reagents that could not be mapped to the genome.


Homology of RNAi reagents



This file contains the original tab-delimited BLAST output to determine the homology of the designed reagents to sequences in the transcriptome (see example above).


Links to input text files



Reagent sequence input file

FASTA file containing the original target sequences queried.

Validated reagent sequence input file

FASTA file containing the validated target sequences queried (e.g. N's are not tolerated in query sequences).

Options input file

Summary of queried design settings in a 'OPTION=VALUE' style.


Links to output report files



Failed design(s)

This file contains a list of identifiers of all queried target sequences where no reagent design was possible under the selected settings.


Download complete HTML report



The complete HTML report including all flat files can be downloaded as *.tar.gz archive. After unpacking it the index.html file in the main folder will open the report in any internet browser. To see GBrowse visualization of the designs an internet connection is required, since these images are produced by the GBrowse instances on our site.


Outputs specific to siRNA reagents


The design and evaluation of siRNAs comes with specific outputs described below.


siRNA information



siRNA sequence

siRNA sense-strand sequence (5'-3').

Position in queried target

Starting position of the siRNA in the queried target sequence (starting at 0).

Length [nt]

Length (in nt) of the siRNA.

siRNA location(s)

Location of the siRNA in the genome of the organism in the format chromosome:start..end(orientation). For some organisms, where the genome is not completely assembled, the amplified product is mapped to contigs.


Reagent quality (siRNA)



siRNAs [19 nt]

Number of siRNA sequences.

On-target

Number of specific siRNAs, only targeting transcripts of a single (intended) target gene.

Off-target

Number of unspecific siRNAs targeting transcripts of unintended genes besides those of the intended target gene.

No-target

Number of siRNAs with no target. This might occur e.g. in case an intron spanning long dsRNA was designed.

Efficiency score

Efficiency score of the designed siRNA according to the selected efficiency calculation method ('rational' or 'weighted'). The efficiency calculation is based on 19 nt siRNAs and can take values between 0 and 100. A more detailed description of the efficiency prediction is available here.

LowComplexRegions

Number of low complexity regions (calculated with mDust) in the siRNA sequence. This value optimally should be 0.

CAN

Number of stretches with at least 6 contiguous CA[ACGT] (CAN) repeats. This value optimally should be 0.


Evaluation of siRNA pools


The evaluation of pooled siRNA reagents is a summarized report of the properties of the single siRNAs. The order of siRNA sequences, locations, efficiencies etc. equals the order of the siRNA identifiers in the header (separated by comma). An example is presented below.




  • No labels